Page d'accueil Offres par pays India: Offres

Tender Notice for the Executive Engineer, Highway Division, Hafizabad. (Offre №93786763fr)

S'inscrire

Partager:
Country: India
Langue: EN
Nombre: 93786763
Date de publication: 07-11-2023
Source:

La description

Les informations complètes sur l'appel d'offres sont fermées.
Pour plus d'informations sur le site, lisez les informations ci-dessous.

À propos de nous

Premier moteur de recherche pour les appels d'offres et les achats en Russie et dans le monde

  • La plus grande base de données d'appels d'offres et de sources d'approvisionnement en Russie et dans le monde
  • Newsletter quotidienne gratuite selon vos paramètres
  • Informations sur les lauréats dans le format dont vous avez besoin
  • Affichage pratique et téléchargement d'informations

Choisissez-nous

Mise en route

Inscription sur le site, après quoi les fonctions du site suivantes sont à votre disposition:

  • Abonnez-vous à des listes de diffusion gratuites pour vos phrases clés
  • Afficher les annonces d'appels d'offres
  • Exporter les informations récapitulatives au format Excel
  • Voir une partie des informations sur les gagnants, fournisseurs et clients des appels d'offres

Enregistrement

Pour utiliser toutes les fonctions du site et afficher toutes les informations, vous devez créer un compte commercial

  • Tarif sélectionné
  • Payez l'accès de l'une des manières possibles

Accès total
Quotations are hereby invited for the following: Research Consumables: qPCR master mix. Scope: - Probe qPCR Master Mix - 500 reactions, Qty: 02. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Source: ONLINE TENDERS

Quotations are hereby invited for the following: Research Consumables: SDS qPCR Assay - Probes and Primers. Scope: - qPCR Probe: ProFsgq1 - TGAATGCCATAGGTCAGAT with FAM+MGBNFQ, Qty: 1; - qPCR Probe: FSGq - TCTTCTAGGATGGGCTGGT with FAM+MGBNFQ, Qty: 1; - qPCR Probe: FVMGB - ACTCAGCGCCCAGGA with FAM+MGBNFQ, Qty: 1; - Probe: FvIGS - ATAGGGTAGGCGGATCTGACTTGGCG with FAM+TAMRA, Qty: 1; - qPCR Probe: FvPrb3 - TTTGGTCTAGGGTAGGCCG with FAM+MGBNFQ, Qty: 1; - Probe: FbPrb1 - TGGGATGCCCT+AATTTTT+ACGG with HEX + 3IABkFQ, Qty: 1; - Primer: Fsgq1F - GATACCCAAGTAGTCTTTGCAGTAAATG, Qty: 1; - Primer: FSGq1 - GGCTGAACTGGCAACTTGGA, Qty: 1; - Primer: FVF - GCAGGCCATGTTGGTTCTGTA, Qty: 1; - Primer: FvIGSF1 - GGTGGTGCGGAAGGTCT, Qty: 1; -Primer: F63 - GTAAGTGAGATTTAGTCTAGGGTAGGTGAC, Qty: 1; - Primer: FbF2 - AGGTCAGATTTGGTATAGGGTAGGTGAGA, Qty: 1; - Primer: Fsgq1R - TTAATGCCTAGTCCCCTATCAACAT, Qty: 1; - Primer: FSGq2 - CAAAGCTTCATTCAATCCTAATACAATC, Qty: 1; - Primer: FVR: GCACGTAAAGTGAGTCGTCTCATC, Qty: 1; - Primer: FvIGSR3 - GTGAGTCGTCTCATC, Qty: 1; - Primer: R6 - GGGACCACCTACCCTACACCTACT, Qty: 1; - Primer: FbR2 - CGGACCATCCGTCTGGGAATTT, Qty: 1. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Source: ONLINE TENDERS

Quotations are hereby invited for the following: Research Consumables: SDS qPCR Assay - Probe and Primers. Scope: - DNA Probe: 33P-GGATGGCAACGTACGTGACCCT with 6FAM + IBFQ, Qty: 01; - DNA Primer: 382F-ACCCAACAGACACTGTGCTC, Qty: 02; - DNA Primer: 49R-CAGTTTGTCAGTAATCGGTATTCG, Qty: 02. Address: ARC-PHP, off Adam Tas road (Behind Distell), Vredenburg farm/campus, Stellenbosch, Banhoek, 7600. Source: ONLINE TENDERS

Extension of Closing Date: Bids are hereby invited for the following: Establishment of a panel of legal practitioners (attorneys and advocates) to the state for a period of thirty-six (36) months. Province: National. Source: ONLINE TENDERS

Addendum: Extension of Closing Date and Amendment to Document: Quotations are hereby invited for the appointment of a service provider to assist the DFFE/MLRF to conduct socio-economic study on hake handline, oysters, and white mussels for a period of 12 months. Scope: The study shall include but not limited to: - Evaluate the economic performance of the hake handline, oysters, and white mussel commercial fishing sectors, including revenue, profitability, and contribution to the local and national economy; - Examine the social implications of the hake handline, oysters, and white mussel commercial fishing sectors, including their role in providing employment, income distribution, and community well-being, particularly among small scale fishers; - Map out the entire value chains for the hake handline, oysters, and white mussel commercial fishing sectors, from harvesting and processing to distribution and consumption, highlighting key stakeholders and interactions. Delivery Address: Foretrust building, Cape Town, 8001. Please confirm the contract number as two were published. Source: ONLINE TENDERS

Tender Notic Source: PPRA SERVICES PORTAL